Review





Similar Products

94
Thermo Fisher hs gapdh 1 sg quantitect primer assay qt00079247 qiagen
Hs Gapdh 1 Sg Quantitect Primer Assay Qt00079247 Qiagen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pm41931390-215-271-267?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
hs gapdh 1 sg quantitect primer assay qt00079247 qiagen - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
OriGene gapdh
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Gapdh, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pmc13209369-269-4-13?v=OriGene
Average 94 stars, based on 1 article reviews
gapdh - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

86
Sangon Biotech primers for gapdh
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Primers For Gapdh, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pmc13138032-55-0-7?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
primers for gapdh - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer of gapdh
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Primer Of Gapdh, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pmc13127400-68-0-10?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
primer of gapdh - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer gapdh f gggtgtgaaccatgagaagt
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Primer Gapdh F Gggtgtgaaccatgagaagt, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pmc13018907-35-0-8?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
primer gapdh f gggtgtgaaccatgagaagt - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Sangon Biotech primer gapdh r cagtgatggcatggactgtg
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Primer Gapdh R Cagtgatggcatggactgtg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pmc13018907-36-0-8?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
primer gapdh r cagtgatggcatggactgtg - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

95
OriGene gadph primers
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Gadph Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/bio_rxiv__64898__2026__04__01__715918-208-0-2?v=OriGene
Average 95 stars, based on 1 article reviews
gadph primers - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

94
OriGene origene qstar
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Origene Qstar, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pm41881279-119-11-11?v=OriGene
Average 94 stars, based on 1 article reviews
origene qstar - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

95
OriGene housekeeping gene gapdh
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Housekeeping Gene Gapdh, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pm41844052-417-7-13?v=OriGene
Average 95 stars, based on 1 article reviews
housekeeping gene gapdh - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

86
Sangon Biotech human gapdh internal primer
SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 <t>and</t> <t>Nrf2)</t> after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to <t>GAPDH</t> mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Human Gapdh Internal Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/gapdh+primers/pm41906758-29-0-8?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
human gapdh internal primer - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

Image Search Results


SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 and Nrf2) after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to GAPDH mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.

Journal: Molecules

Article Title: Subcritical Water Extract from Grape Pomace Protects Human Bronchial Epithelium Cells by Mitigating Oxidative Stress Through Nrf2 Pathway

doi: 10.3390/molecules31101736

Figure Lengend Snippet: SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 and Nrf2) after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to GAPDH mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.

Article Snippet: The primers used were GAPDH (Proligo USA, Milan, Italy), Nrf2 ( HP209154 , OriGene Technologies, Inc., Rockville, MD, USA) and HO-1 ( HP205872 , OriGene Technologies, Inc., USA).

Techniques: Western Blot, Quantitative RT-PCR, Gene Expression, Expressing, Control, Incubation